NRRL29473_and_AF36_progeny_AF-MIT-4

Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progeny of NRRL 29473 and AF36. Corresponds to the primer pair AF-MIT-4 (F: GCTAAAGTTATAGGAGGTGAAGT, R: GCAACCTTTAGCTTCAATAAACCC).