NRRL29507_and_NRRL21882_progeny_AF-MIT-3

Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progeny of NRRL 29507 and NRRL 21882. Corresponds to the primer pair AF-MIT-3 (F: AGCAGAGGGTTCTGCGTTT, R: GCAGATCAACCTGCTAATAATATTCC).