NRRL29537_and_NRRL29536_progeny_AF-MIT-1

Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progeny of NRRL 29537 and NRRL 29536. Corresponds to the primer pair AF-MIT-1 (F: TGAAGCAACTGGATTATTCGCA, R: AAACCACATTCAAAAGCGCT).