Samples included in DNA barcode analyses

Supplement S1. Samples included in DNA barcode analyses. Tables summarize collection information, the life stage of each sample (egg, larva or adult), host plant family / species and sequence quality (percentage of untrimmed bases of high-quality, HQ%). DNA amplifications were performed with the Folmer primers: GGTCAACAAATCATAAAGATATTGG (F) and TAAACTTCAGGGTGACCAAAAAATCA (R).